UVAS Library

Your cart is empty.

Your search returned 2 results. Subscribe to this search

Not what you expected? Check for suggestions
Unhighlight Highlight
|
1.
No cover image available
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice

by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr. SUMMARY 132 Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited SUMMARY 133 elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).

Place hold Add to cart
2.
No cover image available
Epidemiology And Control Of Gastro-Intestinal Nematodes Of Large Ruminants In Balochistan

by Muhammad Ramzan (2009-VA-653) | Dr. Nisar Ahmad | Prof. Dr. Muhammad Azam Kakar | Prof. Dr. Kamran Ashraf | Prof. Dr. Aneela Khurram.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: The main area of research in this study was to assess the prevalence, hematological aspects of Bovine nematodiasis. Three main experiments were conducted to highlight the objectives of the present research study. The first experiment was conducted to find out the prevalence of large ruminants major nematodes for one year. For this purpose buffalo and cattle of either sexes and between < 1 year to > 2 years of age were selected from two sites i.e., Quetta and Qilla Abdullah. Fecal analysis of these cattle and buffalo showed overall higher (33.99%) nematodes prevalence recorded in buffalo in Quetta, (27.99%) in cattle at Qilla Abdullah followed by in cattle at Quetta (26.66%). Five nematode infection was recorded in all two experimental sites with higher prevalence of Haemonchus contortus in buffalo at Quetta and Ostertgia ostertagi in cattle at Quetta and Qilla Abdullah. The buffalo and cattle of < 1 year presented higher nematodes prevalence than 1-2 years and > 2 years. The female buffalo and cattle were infected with nematodes prevalence higher than male animals. These five nematodes were prevalent almost throughout the year, however a peak infection was recorded during August and September in cattle and October in buffalo. The high temperature, rainfall and humidity during these months may be predisposing factor of higher prevalence. Mostly the level of nematodes infection was low(< 800 EPG) and did not seriously impaired the buffalo and cattle productivity. Second experiment on assessing the comparative efficacy of anthelmintics (Levamisole, Oxafendazole and Ivermectin) against cattle and buffalo nematodes were conducted at Govt and private farms. The results showed that Ivermectin than Oxfendazole were found effective against cattle and buffalo nematodes. The higher (89-100%) reduction of EPG were recorded in cattle and 87 buffalo calves treated with Ivermectin followed by Oxfendazole (86-100%), Levmisole (88- 100%). Third experiment was conducted to determine the hematological values in healthy and nematodes infected animals. Different hematological parameters i.e., TEC, TLC, Hb estimation, were determined. The results showed that overall low Hemoglobin estimation and RBC were recorded in nematodes infected animals than healthy, while higher WBC were recorded in nematodes infected animals than healthy. The Lymphocytes and Neutrophil and Monocytes were higher in some nematodes and lower in other, while higher mean Eosinophil counts was recorded in all nematodes infected animals than healthy animals. Availability: Items available for loan: UVAS Library [Call number: 2730-T] (1).

Place hold Add to cart

Implemented and Maintained by UVAS Library.
For any Suggestions/Query Contact to library or Email:rehana.kousar@uvas.edu.pk Phone:+91 99239068
Website/OPAC best viewed in Mozilla Browser in 1366X768 Resolution.